Skip to main content

Full text of "Characterization of directed differentiation by high-throughput single-cell RNA-Seq"

See other formats


Soumillon et al. Supplementary Information 

Materials and Methods 
Cell culture 

Human adipose-derived stem/stromal cells (hASCs) isolated from lipoaspirates and purified by 
flow-cytometry (CD29, CD44, CD73, CD90, CD105 and CD166 positive; CD14, CD31, CD45 and 
Linl negative) were obtained from Life Technologies (lot# 2117 for SCRB-seq and lot# 2118 for 
single cell RT-qPCR and single molecule FISH). 

The hASCs were cultured in a 2% reduced serum medium (MesenPro RS, Life Technologies) and 
expanded for no more than 3 passages. The cultures were then induced to differentiate towards 
an adipogenic fate after reaching 80% confluency (differentiations Dl and D2) or two days after 
reaching 100% confluency (differentiation D3, and for qPCR and smFISH) by switching from 
growth medium to the StemPro adipogenesis differentiation medium (Life Technologies). 
Following induction, the differentiation medium was changed every three days for up to 14 
days. The variation in initial conditions (confluency upon differentiation) was introduced to 
assess the robustness of the subsequent time course data. 

Single cell isolation 

Cells were harvested using TrypLE Express (Life Technologies) and medium removed by pelleting 
the cells in a centrifuge (5 min at 1000 rpm). RNA was stabilized by immediately resuspending 
the pelleted cells in RNAprotect Cell Reagent (Qiagen) and RNaseOUT Recombinant 
Ribonuclease Inhibitor (Life Technologies) at a 1:1000 dilution. 

Just prior to fluorescence-actived cell sorting (FACS), the cells were diluted in PBS (pH 7.4, no 
calcium, magnesium or phenol red; Life Technologies) and stained for viability using Hoechst 
33342 (Life Technologies). 384-well SBS capture plates were filled with 5uJ of a 1:500 dilution of 
Phusion HF buffer (New England Biolabs) in water and cells were then sorted into each well 
using a FACSAria II flow cytometer (BD Biosciences) based on Hoechst DNA staining 
(Supplementary Figure 3, top). After sorting, the plates were immediately sealed, spun down, 
cooled on dry ice and then stored at -80°C. 

For lipid content-based FACS, cells were also stained with HSC LipidTOX Neutral Lipid Stain (Life 
Technologies) and sorted according to their relatively "high" or "low" lipid content 
(Supplementary Figure 3, bottom), either by taking the top and bottom 20% of stained cells (D2) 
or the top and bottom 50% (D3). 

The plates collected for SCRB-seq analysis are summarized in Supplementary Table SI. 
SCRB-Seq of sorted single cells 

Frozen cells were thawed for 5 minutes at room temperature. For the second time course (D3) 
only, we further optimized lysis conditions by adding treatment with proteinase K (200u.g/mL; 



1 



Soumillon et al. Supplementary Information 



Ambion) followed by RNA desiccation to inactivate the proteinase K and simultaneously reduce 
the reaction volume (50 °C for 15 in sealed plate, then 95 °C for 10 min with seal removed ). 

The key library construction steps are summarized in Supplementary Figure SI. To start, diluted 
ERCC RNA Spike-In Mix (lu.1 of 1:10 7 for D1/D2 or lu.1 of 1:10 6 for D3; Life Technologies) was 
added to each well and the previously described template switching reverse transcription 
reaction 1 was then carried out using either SmartScribe Reverse Transcriptase (D1/D2; 
Clontech) or Maxima H Minus Reverse Transcriptase (D3; Thermo Scientific), our universal 
adapter E5V6NEXT (1 pmol, Eurogentec): 

5 ' -lClGlCACACTCTTTCCCTACACGACGCrGrGrG-3 ' 

where iC: iso-dC, iG: iso-dG, rG: RNA G, and our barcoded adapter E3V6NEXT (1 pmol, Integrated 
DNA Technologies): 

5 ' —/ 5B1 osg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT [BC6]N 10 T 30 VN-3 ' 

where 5Biosg = 5' biotin, [BC6] = 6bp barcode specific to each cell/well (Supplementary Table 
S2), N 10 = Unique Molecular Identifiers. 

Following the template switching reaction, cDNA from 384 wells were pooled together, and 
then purified and concentrated using a single DNA Clean & Concentrator-5 column (Zymo 
Research). Pooled cDNAs were treated with Exonuclease I (New England Biolabs) and then 
amplified by single primer PCR using the Advantage 2 Polymerase Mix (Clontech) and our 
SINGV6 primer (10 pmol, Integrated DNA Technologies): 

5 ' -/5B±osg/ACACTCTTTCCCTACACGACGC-3 ' 

Full length cDNAs were purified with Agencourt AMPure XP magnetic beads (0.6x, Beckman 
Coulter) and quantified on the Qubit 2.0 Flurometer using the dsDNA HS Assay (Life 
Technologies). Full-length cDNA was then used as input to the Nextera XT library preparation kit 
(lllumina) according to the manufacturer's protocol, with the exception that the i5 primer was 
replaced by our P5NEXTPT5 primer (5u.M, Integrated DNA Technologies): 

5 ' -AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T*-3 ' 

where * = phosphorothioate bonds. 

The resulting sequencing library was purified with Agencourt AMPure XP magnetic beads (0.6x, 
Beckman Coulter), size selected (300-800bp) on a E-Gel EX Gel, 2% (Life Technologies), purified 
using the QIAquick Gel Extraction Kit (Qiagen) and quantified on the Qubit 2.0 Flurometer using 
the dsDNA HS Assay (Life Technologies). 



2 



Soumillon et al. Supplementary Information 

Libraries were sequenced on lllumina Hiseq paired-end flow cells with 17 cycles on the first read 
to decode the well barcode and UMI, an 8 cycle index read to decode the \1 Nextera barcode 
and finally a 34 cycle second read to sequence the cDNA. 

SCRB-Seq on bulk samples 

Populations of both unsorted and sorted cells were lysed in QIAzol (Qiagen) and RNA was 
extracted and purified using Direct-zol RNA MiniPrep (Zymo Research). SCRB-Seq DGE libraries 
were prepared from 10 ng of extracted total RNA, using the protocol previously described for 
single cells with the exception of using more concentrated E3V6NEXT and E5V6NEXT (10 pmol) 
and a version of E3V6NEXT that did not contain the well-specific 6bp barcodes but instead a 
16bp UMI (Integrated DNA Technologies), : 

5 ' -/5Blosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCTN le T 30 VN-3 ' 

Single cell RT-qPCR 

Single cells were sorted into 384-well plates, frozen at -80 °C, thawed for 5 min at room 
temperature, treated with proteinase K (200u.g/mL, Ambion) and desiccated as described above. 
cDNA synthesis was carried out in each well using Superscript VILO (2uJ final volume; Life 
Technologies). qPCR was then performed on the total cDNA output using FAM and VIC Taqman 
probes (Life Technologies) and processed on an Applied Biosystems ViiA 7 Real-Time PCR system 
(Life Technologies). 

Single-molecule FISH 

Probes targeting LPL, G0S2 and TCF25 transcripts were synthesized as amine-conjugated 
oligonucleotides and then labelled with Cy5 (GE Healthcare), Alexa Fluor 594 (Molecular Probes) 
or 6-TAMRA (Molecular Probes; Supplementary Table S3). Hybridizations and washes were 
performed using modifications to previously described procedures 2 . Prior to hybridizations, 
lipids were extracted by incubation of fixed cells in 2:1 chloroform:methanol for 30 min at room 
temperature. Cells were washed quickly with 70% ethanol and then resuspended in 200u.l RNA 
Hybridization buffer containing 2x SSC buffer, 25% Formamide, 10% Dextran Sulphate (Sigma), 
E. coli tRNA (Sigma), Bovine Serum Albumin (Ambion), Ribonucleoside Vanadyl Complex and 150 
ng of each desired probe set (the mass refers only to pooled oligonucleotides, excluding 
fluorophores, and is based on absorbance measurements at 260 nm). Hybridizations were 
performed for 16-18 h at 30 °C, after which cells were washed twice for 30 min at 30 °C in RNA 
Wash buffer (containing 2x SSC buffer, Formamide 25% (Ambion) and 100 ng/ml DAPI). For 
microscopy, cells were resuspended in a mounting solution containing 1 x PBS 0.4% Glucose, 
100 u.g/ml Catalase, 37 u.g/ml Glucose Oxidase and 2 mM Trolox and immobilized on poly-l- 
lysine coated chambered cover glasses. 

Imaging was performed as described earlier 3 using an inverted epi-fluorescence microscope 
(Nikon) equipped with a high-resolution CCD camera (Pixis, Princeton Instruments) and a 100X 
magnification oil immersion, high numerical aperture Nikon objective. An image stack consisting 



3 



Soumillon et al. Supplementary Information 

of 50 image planes spaced 0.3 u.m apart was acquired per region of interest. Individual images 
were filtered with a high-pass Fast Fourier Transform filter, where the filter cutoff was chosen to 
preserve diffraction-limited signals. Filtering was repeated on the resulting image of the 
maximum projection. Signal positions, widths, and intensities were quantified by fitting 2D 
Gaussians approximating the point-spread function (PSF) of the microscope. To separate 
sporadic signals caused by autofluorescence or non-specifically bound probes from real mRNA 
signals, signals were filtered based on width and signal-to-noise ratio. Cells were segmented 
manually and signals were assigned to individual cells. 

Computational analysis of sequence data 

All second sequence reads were aligned to a reference database consisting of all human RefSeq 
mRNA sequences (obtained from the UCSC Genome Browser hgl9 reference set: 
http://genome.ucsc.edu/), the human hgl9 mitochondrial reference sequence and the ERCC 
RNA spike-in reference sequences using bwa version 0.7.4 4 with non-default parameter "-I 24". 
Read pairs for which the second read aligned to a human RefSeq gene were kept for further 
analysis if 1) the initial six bases of the first read all had quality scores of at least 10 and 
corresponded exactly to a designed well-barcode and 2) the next ten bases of the first read (the 
UMI) all had quality scores of at least 30. Digital gene expression (DGE) profiles were then 
generated by counting, for each microplate well and RefSeq gene, the number of unique UMIs 
associated with that gene in that well. Python scripts implementing the alignment and DGE 
derivation are available from the authors upon request. 

Computational analysis of DGE profiles 

All computational and statistical analyses were performed using Python 2.7 with the Enthought 
Canopy Distribution (http://www.enthought.com), Numpy 1.8.0 and Scipy 0.13.0 
(http://www.scipy.org/), scikit-learn 0.14 (http:// http://scikit-learn.org/) and Matplotlib 1.3.1 
(http://matplotlib.org/). 

For each plate, wells with less than 1,000 or more than 10,000 total UMI counts were 
discarded (24% of all wells, largely low-value wells). The UMI counts for each gene in the 
remaining wells were then normalized by dividing by the sum of UMI counts across all genes in 
the same well. We emphasize that this normalization removes variation from differences in RNA 
content per cell and should be revisited for analyses that are sensitive to this phenomenon. 

Pairwise Pearson correlations between genes across single cells and their associated p- 
values were computed using the scikit-learn metrics .pairwise_distances function. 
The 5% false discovery rate (FDR) thresholds were estimated from the p-value distribution using 
the Benjamini-Hochberg-Yukeli procedure 5 . The expected null distributions of pairwise 
correlation coefficients were estimated by permuting expression values across cells from the 
same time point and re-computing the pairwise correlations 100 times. 

Principal component analyses (PCA) were performed by first scaling the normalized 
UMI-derived expression levels of each gene to zero mean and unit variance using the scikit-learn 
preprocess . scale function and then applying the RandomizedPCA transformation. Each 
time course dataset was processed separately. To project lipid-sorted cell data into the 



4 



Soumillon et al. Supplementary Information 

corresponding time course PC space, the time course and lipid-sorted expression values were 
concatenated and re-scaled prior to applying the time course PCA transformation. 

Gene set enrichment analyses (GSEA) were performed using the GSEAPreRanked 
module of the GSEA 2.0 software (http://www.broadinstitute.org/gsea/) with the MSigDB 4.0 
gene sets 6 . Genes were ranked by the PC weights for interpretation of PC metagenes or by the 
signal to noise metric (u. A +u. B /a A -a B ) for comparisons of low and high lipid cells. Significant gene 
sets were called at the threshold recommended by the GSEA developers (25% FDR). 



5 



Soumillon et al. Supplementary Information 
Supplementary Figure Legends 

Figure SI - Overview of the SCRB-Seq library construction protocol. Note that for simplicity, 
modified nucleotides are not shown. See Supplementary Methods for details. 

Figure S2 - FACS using Hoechst DNA (A) and LipidTOX neutral lipidstaining (B) for cells 
differentiated at ~80% confluency (D1/D2) or 2days after full confluency (D3). A significant 
decrease in 4N cells can be observed between days 0 and 1 in the initial time course, which is 
consistent with exit from the mitotic cell cycle, while more cells had already stopped dividing in 
the more confluent culture. The offset distribution for day 14 cells in the Hoechst analysis is a 
technical artefact. 

Figure S3 - Differentiating human adipose-derived stem/stromal cells (hASCs) with hematoxylin 
and oil red O staining. Independent cultures and differentiations used to check reproducibility of 
the cell culture protocol. The top two panels show a preliminary time course that was not 
harvested for profiling. The bottom row shows cells cultured during the Dl time course. 

Figure S4 - Comparison RefSeq gene expression levels as estimated from the total number of 
aligned sequencing reads (raw) or the total number of unique UMIs. Each dot compares the 
mean raw counts across all profiled cells in the first time course (Dl) to the mean UMI counts 
for the same gene. The raw and UMI counts are strongly correlated, but the UMI counts correct 
for a systematic bias in the raw expression levels of a subset of genes, which is likely caused by 
preferential PCR amplification or sequencing. 

Figure S5 - Relationship between the proportion of cells where a gene was detected (UMI count 
> 1) and its estimated expression level from bulk RNA profiling. Data is shown for day 0 of the 
D3 differentiation time course. Solid line indicates the medians and the top and bottom dotted 
lines the 90 th and 10 th percentiles, respectively. UPM = UMI counts for a gene per million UMI 
counts from all genes. Lack of detection of any one gene in a cell can be attributed to a 
combination of technical and biological variation. 

Figure S6 - Excess of positively and negatively correlated gene pairs at selected time points in 
the Dl and D3 time courses. Red indicates the observed number of genes showing a specific 
pairwise correlation. Blue indicates the estimated null distribution obtained by permuting gene 
expression levels across cells prior to computing the correlation coefficients. FDR = false 
discovery rate. 

Figure S7 - Comparison of A) SCRB-Seq and B) smFISH data for LPL and G0S2 during the D3 time 
course. SCRB-Seq values are in UPM, smFISH in mRNAs detected per cell. C) Shows a 
representative smFISH composite image from day 14 with LPL in green, G0S2 in red and a largely 
uncorrelated gene TCF25 in blue, r = Pearson's correlation coefficient. 



6 



Soumillon et al. Supplementary Information 



Figure S8 - Gene expression dynamics at single cell resolution. A-C) Each scatter plot shows the 
first three PCs of the D3 hASC time course. Red dots show cells collected at the indicated time 
point, while blue dots show cells collected at all previous time points. D) Separately sorted cells 
with high and low lipid content from day 7 projected into the same PC space. 



7 



Soumillon et al. Supplementary Information 
Supplementary References 

1. Islam, S. et al. Characterization of the single-cell transcriptional landscape by highly 
multiplex RNA-seq. Genome Res. 21, 1160-7 (2011). 

2. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A. & Tyagi, S. Imaging 
individual mRNA molecules using multiple singly labeled probes. Nat. Methods 5, 877-9 
(2008). 

3. Bienko, M. ef al. A versatile genome-scale PCR-based pipeline for high-definition DNA 
FISH. Nat. Methods 10, 122-4 (2013). 

4. Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler 
transform. Bioinformatics 25, 1754-60 (2009). 

5. Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: a practical and powerful 
approach to multiple testing. J. R. Stat. Soc. Ser. B. 57, 289-300 (1995). 

6. Subramanian, A. ef al. Gene set enrichment analysis: a knowledge-based approach for 
interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545- 
50 (2005). 



8 



igure S1 



Template switching 

1st strand cDNA 

2nd strand cDNA 



5'-RNA:NB(A)30-3' 
3 ' -CCC : cDNA : NV ( T ) 30 (N ) 10 [ BC6 ] TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA-5 ' 



5 ' -ACACTCTTTCCCTACACGACGCGGG : cDNA : NB ( A ) 30-3 ' 

CCC : cDNA : NV ( T ) 30 ( N ) 10 [ BC6 ] TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA-5 ' 



Resulting full length cDNA 



5 ' -ACACTCTTTCCCTACACGACGCGGG : cDNA : NB ( A ) 30 (N ) 10 [BC6 ] AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3 1 
3 ' -TGTGAGAAAGGGATGTGCTGCGCCC : cDNA : NV ( T ) 30 (N ) 10 [BC6 ] TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA-5 1 



Full length cDNA amplification: 

Single primer PCR 

3- ' CGCAGCACATCCCTTTCTCACA-5 ' 

5 ' -ACACTCTTTCCCTACACGACGCGGG : cDNA : NB ( A) 30 ( N ) 10 [BC6 ] AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3 ' 
3 ' -TGTGAGAAAGGGATGTGCTGCGCCC : cDNA : NV ( T) 30 ( N ) 10 [ BC6 ] TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA-5 ' 
5 ' -ACACTCTTTCCCTACACGACGC-3 ' 



Transposon based library (Nextera) 

Tagmentation 

5 ' -ACACTCTTTCCCTACACGACGCTCTTCCGATCT [ BC6 ] ( N ) 10 ( T ) 30VN-F rag-3 ' 

3 ' -Frag-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG-5 ' 



Library amplification (modified) 

3 ' -GGCTCGGGTGCTCTG [ i7 ] TAGAGCATACGGCAGAAGACGAAC-5 ' 
5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6] (N) U (T) 3»VN-Frag-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3 ' 
3 '-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA [BC63 (N) 10(A) 3nBN-Frag-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG-5 ' 
-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' 



Resulting library 

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT [BC6] ( N ) 10 ( T ) 30VN-F rag-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC [ i7 ] ATCTCGTATGCCGTCTTCTGCTTG 3' 
TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA [BC6] ( N ) 10 ( A ) 30BN-F rag-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG [ i7 ] TAGAGCATACGGCAGAAGACGAAC 5' 



Sequencing 

Read 1 [BC6] + UMI (Nhe — > 

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTIBC6] (N)i B (T)30VN-Frag-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC [i7] ATCTCGTATGCCGTCTTCTGCTTG 3' 
TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA [BC6] (N)i0(A)30BN-Frag-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG [i7] TAGAGCATACGGCAGAAGACGAAC 5' 

Read 2 Nextera Index [i7] — > 
< — Read 3: 3' end cDNA fragment 



ure S2 



Differentiation started 
at 80% confluency 



Differentiation started 
2 days after full confluency 



100- 
80- 

E 

13 

60- 

x 

03 



40- 
20- 

0 



□B DayO 

□□ Day1 

□B Da y 2 

BB Day 3 

BB Day5 

BB Day 7 

BB Day 9 

■B Day 14 



2N 



4N 



ill 



10 



10 



10^ 



100 
80 
60 
40- 
20- 
0 



BB DayO 

BB Day 3 

BB Day 7 

■B Day 14 



2N 




Hoechst 



10 



10 



10^ 



B 



Differentiation started 
2 days after full confluency 
replicate 1 



Differentiation started 
2 days after full confluency 
replicate 2 





500- 


Day 14 « 












"a5 


400- 




0 


a 






a 


o 

i— 


300- 




o 

l_ 


0) 






0 


_Q 








E 


200- 




E 


13 










100- 


I V20% 






0 - 


-20%/ 'T ' 





w 300 



200 



100 



0 10 



10 



10 



10 




PE-Texas Red 
LipidTOX 



I | Sorted cell populations based on either low or high lipid content 



Figure S3 



day 0 



day 3 



day 7 



day 14 




c '■' 'F : 



— * * * 



V >V ^ v - /* ' ' 





Preliminary 
differentiation, 
unstained 



Preliminary 
differentiation, 
hematoxylin 
Oil Red O 



Differentiation 

D1, 
hematoxylin 
Oil Red O 



50jim 



Figure S4 




ure S5 




Bulk cell expression level (log-ioUPM) 



Figure S6 



B 



D1, day 0 



5% FDR 



• Observed 

• Null 



CD 
£= 
<D 
(3 



CD 
c 

<D 

C3 




-0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 
Pairwise correlation (r) 

D1,day7 5% FDR 



CD 

(3 



10 6 
10 5 
10 4 
10 3 
10 2 
10 1 



10 l 





• Observed 




• Null 


• 





-0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 
Pairwise correlation (r) 



D3, day 0 



5% FDR 



CD 



10° 
10 5 
10 4 
10 3 
10 2 
10 1 
10° 





JI IV • Observed 






t . Null 






a 1 * 



-0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 
Pairwise correlation (r) 



D3, day 3 



5% FDR 



CD 

(3 



10 6 
10 5 
10 4 
10 3 
10 2 
10 1 
10° 







• Observed 






• Null 


• 







-0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 
Pairwise correlation (r) 



D3, day 7 



5% FDR 



Observed 
Null 



CD 

(3 




-0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 
Pairwise correlation (r) 



Figure S7 



Day 0, r— 0.02, p=0.44 



B 




1000 2000 3000 4000 5000 
G0S2 



Day 3, r=0.18, p=7.8 x 1Q' ! 




5000 
4000 
3000 
2000 
1000 
0 



1000 2000 3000 4000 5000 
G0S2 

Day 7, r=22, p=5.9 x 1Q- 13 



1000 2000 3000 4000 5000 
G0S2 



300 



200 



100 . 



Day 0, r=0.25, p=3.5 x 10" 




300 



200 



100 



50 100 150 200 250 

G0S2 

Day 3, r=0.51, p=4.3x10" 27 



300 



200 



Day 7, r=0.85, p=6.9 x 10" ! 



300 




100 150 200 250 300 
G0S2 




100 150 200 250 300 
G0S2 



300 



200 



100 



Day 14, r=0.84, p=1.2 x 10 _ 



0 50 100 150 

G0S2 



200 250 300 




■ • 

■ 



Figure S8 




Table SI - Profiled hASC samples 



Plate ID 


Diffprpntiation 

\ 1 C 1 CI 1 LldLIUI 1 




Time 
point 


Sorting 


STRR-^pn variant 

JV«I\U 3Cl| Vnlldlll 


Ul I UA 


Differentiation 1, 


80% confluency 


Day 0 


Hoechst only 


SmartScribe 


D1T0B 


Differentiation 1, 


000/ nnnflnnnm 

oU/o contiuency 


Day 0 


Hoechst only 


SmartScribe 


m Tnr 


Differentiation 1, 


ou/o conriuency 


Day 0 


Hoechst only 


SmartScribe 


Ul I 1A 


Differentiation 1, 


ou/o conriuency 


uay i 


Hoechst only 


SmartScribe 


m ti c 
Ul 1 lb 


Differentiation 1, 


ou/o conriuency 


Day 1 


Hoechst only 


SmartScribe 


Ul I 1L 


Differentiation 1, 


O 00/ AAnfL inn s->i j 

ou/o conriuency 


Day 1 


Hoechst only 


SmartScribe 


Ul I ZD 


Differentiation 1, 


ou/o conriuency 


uay z 


Hoechst only 


SmartScribe 


Ul I ZL 


Differentiation 1, 


ou/o conriuency 


udy z 


Hoechst only 


SmartScribe 


Ul I zu 


Differentiation 1, 


ou/o conriuency 


Day 2 


Hoechst only 


SmartScribe 


Ul I 3d 


Differentiation 1, 


su/o conriuency 


uay 3 


Hoechst only 


SmartScribe 


Ul I 3L 


Differentiation 1, 


ou/o conriuency 


Haw 3 

uay 3 


Hoechst only 


SmartScribe 


Ul I 3U 


Differentiation 1, 


su/o conriuency 


uay 3 


Hoechst only 


SmartScribe 


Ul I dA 


Differentiation 1, 


isu/o conriuency 


Day 5 


Hoechst only 


SmartScribe 


Ul I DL 


Differentiation 1, 


su/o conriuency 


uay d 


Hoechst only 


SmartScribe 


ni Ten 

Ul I jU 


Differentiation 1, 


su/o conriuency 


uay d 


Hoechst only 


SmartScribe 


HI T"7 A 

Ul I /A 


Differentiation 1, 


O 00/ r/ >n-fli Inn J 

ou/o conriuency 


n-iw "7 

uay / 


Hoechst only 


SmartScribe 


ni T~7R 
Ul I / D 


Differentiation 1, 


OflO/ rnnfli innni 

ou/o conriuency 


n^w "7 
uay / 


Hoechst only 


SmartScribe 


D1T7C 


Differentiation 1, 


O 00/ mn-fli Inn n\ / 

au/o conriuency 


Day 7 


Hoechst only 


SmartScribe 


m TQ A 

ui i yA 


Differentiation 1, 


O nO/ rf ,n-fli m n nw 

au/o conriuency 


Day 9 


Hoechst only 


SmartScribe 


m Tor 

ui i yL 


Differentiation 1, 


OflO/ rnnfli innrvi 

ou/o conriuency 


Day 9 


Hoechst only 


SmartScribe 


D1T14A 


Differentiation 1, 


O nO/ rnnfli inn s*\ / 

isu/o conriuency 


Day 14 


Hoechst only 


SmartScribe 


m T1 A D 
Ul I 14D 


Differentiation 1, 


OAO/ rnnfli innrvi 

ou/o conriuency 


Day 14 


Hoechst only 


SmartScribe 


m T1 A c 
Ul I 14L 


Differentiation 1, 


ou/o conriuency 


uay 14 


Hoechst only 


SmartScribe 


mn a i i a 

UZ I 14LLA 


Differentiation 2, 


full confluency 


uay 14- 


noecnst + Lipid i ua, low npia Traction uower zu/oj 


SmartScribe 


m~n a i i d 

UZ I 14LLD 


Differentiation 2, 


full confluency 


Day 14 


noecnst + Lipid i ua, low npia Traction uower zu/oj 


SmartScribe 


mn a i i c 

UZ I 14LLL 


Differentiation 2, 


full confluency 


Day 14 


noecnst + Lipiu i ua, low npia Traction flower zu/oj 


SmartScribe 


mn A Ul I A 
UZ I 14nLA 


Differentiation 2, 


full confluency 


uay 14 


noecnst + Lipia i ua, nign npia Traction \upper zu/oj 


SmartScribe 


UZ I l^rlLD 


Differentiation 2, 


full confluency 


uay 14 


noecnst + Lipid i ua, nign npia Traction \upper zu/oj 


SmartScribe 


UZ I 14HLL 


Differentiation 2, 


full confluency 


Day 14 


l_l n H-, r n r- + 1 1 ini V "ni/rn 1 1 ni *4 " frnnfirt n / I I n n n 1 HO/ \ 

noecnst + Lipid i ua, nign lipid Traction \upper zu/oj 


SmartScribe 


U j I UA 


Differentiation 3, 


full confluency 


Day 0 


Hoechst only 


Proteinase K + Maxima 


u6 I Ub 


Differentiation 3, 


full confluency 


Day 0 


Hoechst only 


Proteinase K + Maxima 


U 3 I UL 


Differentiation 3, 


full confluency 


Day 0 


Hoechst only 


Proteinase K + Maxima 


D3T3A 


Differentiation 3, 


full confluency 


Day 3 


Hoechst only 


Proteinase K + Maxima 


UJ I 3D 


Differentiation 3, 


full confluency 


uay 3 


Hoechst only 


Proteinase K + Maxima 


U3 I dL 


Differentiation 3, 


full confluency 


uay 3 


Hoechst only 


Proteinase K + Maxima 


ri3T"7 A 
U3 I /A 


Differentiation 3, 


full confluency 


Day 7 


Hoechst only 


Proteinase K + Maxima 


D3T7B 


Differentiation 3, 


full confluency 


Day 7 


Hoechst only 


Proteinase K + Maxima 


D3T7C 


Differentiation 3, 


full confluency 


Day 7 


Hoechst only 


Proteinase K + Maxima 


D3T7LLA 


Differentiation 3, 


full confluency 


Day 7 


Hoechst + LipidTOX, "low lipid" fraction (lower 50%) 


Proteinase K + Maxima 


D3T7LLB 


Differentiation 3, 


full confluency 


Day 7 


Hoechst + LipidTOX, "low lipid" fraction (lower 50%) 


Proteinase K + Maxima 


D3T7LLC 


Differentiation 3, 


full confluency 


Day 7 


Hoechst + LipidTOX, "low lipid" fraction (lower 50%) 


Proteinase K + Maxima 


D3T7HLA 


Differentiation 3, 


full confluency 


Day 7 


Hoechst + LipidTOX, "high lipid" fraction (upper 50%) 


Proteinase K + Maxima 


D3T7HLB 


Differentiation 3, 


full confluency 


Day 7 


Hoechst + LipidTOX, "high lipid" fraction (upper 50%) 


Proteinase K + Maxima 


D3T7HLC 
Qprnnlp in 

Jal 1 1 pic l \J 


Differentiation 3, 

Diff p rpn tint inn 

LSI 1 1 CI CI 1 Lid LIU 1 1 


full confluency 


Day 7 
Time 
point 


Hoechst + LipidTOX, "high lipid" fraction (upper 50%) 

follprtion mnrlp 

ICL.LIU 1 1 II IUUC 


Proteinase K + Maxima 

^fRR-cpn variant 

JL,I\D SCLf vaiiaiu 


D3T0_sorted 


Differentiation 3, 


full confluency 


Day 0 


FACS to tube 


Bulk 


D3T3_sorted 


Differentiation 3, 


full confluency 


Day 3 


FACS to tube 


Bulk 


D3T7_sorted 


Differentiation 3, 


full confluency 


Day 7 


FACS to tube 


Bulk 


D3T14_sorted 


Differentiation 3, 


full confluency 


Day 14 


FACS to tube 


Bulk 


D3T0_unsorted 


Differentiation 3, 


full confluency 


Day 0 


No FACS 


Bulk 


D3T3_unsorted 


Differentiation 3, 


full confluency 


Day 3 


No FACS 


Bulk 


D3T7_unsorted 


Differentiation 3, 


full confluency 


Day 7 


No FACS 


Bulk 


D3T14_unsorted 


Differentiation 3, 


full confluency 


Day 14 


No FACS 


Bulk 



Table S2 - 384-plex inline barecodes used in SCRB-seq RT primers 



SRS WpII 

JL) J VVCM 


Rarrndp Qpt 1 fl~)7 and D7l 


Rarrndp cnt 7 (D^l 


JDJ VVCII 


Rarmrit* cpt 1 I D7 and D7l 

Dal tUUC JC L X \ Lf£. ailU U» £-) 


Rarmdp < 
uai tuuc - 


Al 


AAAGGG 


AAAAGT 

MMMHL I 




CTTCGT 


GGTAGA 
u L 1 rturt 


A2 


AAAGGG 

rtrtrtULU 


AAAATG 

/A/A/A/A I L 


12 


GTTGAG 

L 1 1 UrtU 


GGTTAG 

U L 1 1 rtL 


A3 


AACACG 

rtrtL/ALU 


AAACAT 

nnnUn I 


|3 


CTTGGA 

L 1 1 U Urt 


GGACAT 

UU rtLrt 1 


A4 


AACAGC 

rtrtLrtUL 


AAACTA 

nnnu I /A 


14 


CTTGTC 


GGCAAT 

UU Lrtrt 1 


A5 


aaggag 


AAAGTT 

/A/A/AU P I 


|5 


CTTTCG 


GGGATT 

U U Urt 1 1 


A6 


AArrrA 


AAATAG 

/A/A/A I /AL 


16 


CTTTGC 


GTAGAG 

U 1 /ALrtL 


A7 


aagggt 

/A/AV_V_U I 


AAATGA 

/A/A/A I L/A 


|7 


GAAAGG 

UrtrtrtU u 


GTGAAG 

U 1 LrtrtU 


A8 


AACCTC 

rtrtLL I \— 


AAATGT 

/A/A/A I U I 


18 


GAACAG 

UrtrtLrtU 


GTGACT 

U 1 UrtL 1 


A9 


AACGTG 

/A/A>^.U I U 


AAATTG 

/A/A/A I I U 


19 


GAACCT 

UrtrtLL 1 


GTTfGA 

U 1 1 LUrt 


A 10 


AACTCC 


AACAAT 

/A/AL/A/A I 


no 


GAACGA 

UrtrtLUrt 


TAGTGG 

1 rtU 1 u u 


All 


AAGTGG 

nHL I U U 


AAGATA 

/A/A L/A I rt 


111 


GAAGTG 

Urt rtL 1 L 


TGGAAG 

1 L Lrtrt L 


A12 


AAGAGG 

nnU rtU U 


AAGTAA 

rt/AL I /A/A 


I12 


GAAGGT 

u rtrtu U 1 


TGGAAG 

1 LU rtrtU 


A13 


aagggt 

rtrtU V— I 


AAGATT 


I13 


GAAGTG 

Urt/AU 1 u 


TGTGGA 

1 L 1 U L/A 


A14 


AAGGTG 

/AAA Vj V— I Vj 


AAGTAT 

nnu I /A I 


1 14 


GAATGG 

Urtrt 1 LU 


TTCCTC 


A15 


AAGGAG 


AAGTTA 
rtrtu I I rt 


115 


GAGAGT 

U rtLrt L 1 


TTGTCC 


A16 


AAGGGT 

rtrtU uu i 


AATAAG 

/Art I rt/AL 


116 


GAGATf 

U/ALrt 1 L 


TTTGGC 


A17 


AAGTCG 

rtrtU I LU 


AATACA 

rtrt I rtLrt 


117 


GACCAT 

U/ALLrt 1 


CCAACC 

LLrtrtLL 


A18 


AATrrr 

rtrt I LLL 


AATAGT 
rtrt l rtu I 


118 


GAGGTA 

urtLL 1 rt 


CCTTCC 


A19 


AATGGG 

/A /A I v^uvj 


AATATG 

rtrt I rt I u 


119 


GAGGAA 

U rtL Urtrt 


GTGTGG 

L 1 L 1 LL 


A20 


AATGGG 

/A /A I U U \^ 


AATGAA 

rtrt I Lrt/A 


120 


GAGTAG 

U rtL 1 rtU 


GGAGGA 

U UrtLLrt 


A21 


AC AAGG 


AATCTT 


121 


GAGTGT 

UrtL 1 U 1 


GTAGGG 

U 1 rtLLU 


A22 


AGAGAG 


AATGAT 

rtrt I Urt I 


122 


GAGAAG 
u rtu rtrtu 


Accccr 

rtLLLLL 


A23 


ACACGT 


AATGTA 

rtrt I U I rt 


123 


GAGAGA 

UrtU/ALrt 


AGGGGG 

rtLLLUU 


A24 


ACACTC 

rtL/AL I L 


AATTAG 

rtrt I I rtU 


124 


GAGAGT 

UrtU/AU I 


ACCGCG 

rtLLULU 


Bl 


ACAGAC 

/A^w/AU rA\w 


AATTCT 


Jl 


GAGCAA 

UrtU Lrtrt 


ACCGGC 

rtLLUU L 


B2 


AGAGCA 

rtL/AU ^/A 


AATTGA 

/Art I I U rt 


J2 


GAGGTT 

UrtU L 1 1 


ACGCCG 

/ALU LLU 


B3 


AGAGTG 

rtL/AU I U 


AATTTC 


J3 


GAGGAT 

UrtU Urt 1 


AGGGGG 

/ALU LU L 


B4 


AGATGC 


AGAAAT 

rtLrtrtrt I 


J4 


GAGTAG 

UrtU 1 rtL 


AGGGGG 

/ALU U LL 


B5 


ACCAAG 

rtLL/A/AU 


ACAATA 

rtLrtrt I rt 


J5 


GAGTCT 

UrtU 1 L 1 


ACGGGG 

rtLUU UU 


B6 


ACCACT 

rtLL/AL I 


ACATAA 

rtLrt I rtrt 


J6 


GAGTGA 

UrtU 1 Urt 


AGCCCG 

rtULLLU 


B7 


ACCAGA 

rtLL/AUrt 


ACT AAA 

rtL I rtrtrt 


J7 


GAGTTG 

UrtU 1 1 u 


AGCCGC 

rtULLU L 


B8 


ArrGAT 

rtLLurt I 


ACTATT 


J8 


GATAGG 

urt 1 rtLL 


AGGGGG 

rtu Lu LL 


B9 


aggtga 

HLv, I Lrt 


ACTTAT 


jg 


GATGAG 

Urt 1 LrtL 


AGGGGG 

rtULU UU 


BIO 


AGGTGT 

/A V_ V, I U I 


ACTTTA 


J10 


GATGGA 

Urt 1 LLrt 


AGGGGG 

rtU U LLL 


Bll 


ACCTTC 


AGAATT 

rtUrtrt I I 


Jll 


GATGTG 

Urt 1 L 1 U 


AGGGGG 

rtUU LUU 


B12 


ArGAAr 


AGATAT 

rturt I rt I 


J 12 


GATGAG 

Urt 1 UrtU 


AGGGGG 
rtu u u Lu 


B13 


ACGACA 

/ALUrtLrt 


AGATTA 

rtUrt I I rt 


J13 


GATGGA 

Urt 1 U U rt 


AGGGGG 

rtU U U U L 


B14 


ACGAGT 

/ALUrtU I 


AGTAAT 

rtU I rtrt I 


J 14 


GATGTC 

Urt 1 U 1 L 


LrtLLLL 


B15 


AGGATG 


AGTATA 

rtu I rt I rt 


J15 


GATTGG 
urt 1 1 u L 


GAGGGG 
LrtLLu u 


B16 


AGGGAT 


AGTTAA 

rtU I P rtrt 


J16 


GGAAAG 

U LrtrtrtL 


GAGGGG 

LrtLU LU 


B17 


AGGGTA 


ATAAAG 

rt I rtrt/AL 


J 17 


GGAAGT 

ULrtrtL 1 


GAGGGG 

LrtLU U L 


B18 


AGGGAA 

/ALU U rtrt 


ATAAGA 

rt I rtrtLrt 


J18 


GGAGTT 

U LrtL 1 1 


GAGGGG 
Lrtu LLu 


B19 


AGGTGT 

rtLu I L I 


ATAAGT 
rt l rtrtu I 


J19 


GGATAG 
u Lrt 1 rtu 


GAGGGG 

Lrtu LuL 


B20 


AGGTGA 

/ALU I Urt 


ATAATG 

rt I /Art I U 


J 20 


GGGAAA 

U L Lrtrtrt 


GAGGGG 

L/AU ULL 


B21 


ACTACG 

rA^w I /ALU 


ATACAA 

rt I rtLrtrt 


J21 


GCTATT 

U LLrt 1 1 


CAGGGG 

LrtUU UU 


B22 


ACTCAC 

rA^w I \_rtL 


ATACTT 


J22 


GCTTAT 

U LL 1 rt 1 


CCACCG 

LLrtLLU 


B23 


AGTGCA 

/A V— i ^,^rt 


ATAGAT 

rt I rtUrt I 


J23 


GGGTTA 

U LL 1 1 rt 


GGAGGG 

L LrtLU L 


B24 


AGTGAG 

/A V— I UrtU 


ATAGTA 

rt I rtU I rt 


J 24 


GGGAAT 

U LU rtrt 1 


GGAGGG 

LLrtU U U 


CI 


AGTGGT 


ATATAG 

rt I rt I rtU 


Kl 


GGGATA 

U LU rt 1 rt 


CCCACG 


C2 


AfTGGA 

rtL I UUrt 


ATATCT 


K2 


GCGTAA 

ULU 1 rtrt 


CCCAGC 

LLLrtUL 


C3 


ACTGTC 

rtL I U I L 


ATATGA 

rt I rt I Urt 


K3 


GCGTTT 


CCCCAC 

LLLLrtL 


C4 


ACTTGG 

rtL I I UVJ 


ATATTC 


K4 


GCTAAG 

UL 1 rtrtU 


CCCCCA 

LLLLLrt 


C5 


AGAArr 

rtu MMLL 


ATGAAA 

rt I Lrtrtrt 


K5 


GGTATG 

uL 1 rt 1 L 


GGGGGT 

LLLLu 1 


C6 


AGAGAG 

rtU rtL/AL 


AT C ATT 


K6 


GGTGAA 

UL 1 Lrtrt 


GGGGTG 

LLLL 1 U 


C7 


AGAGGA 

rtU rtL Urt 


ATCTAT 


K7 


GGTGAT 

U L 1 Urt 1 


GGGGAG 

LLLU rtU 


C8 


AGAGTG 

/AUrtL I U 


ATCTTA 


K8 


GGTGTA 

U L 1 U 1 rt 


GGGGGA 

LLLU Urt 


C9 


AGAGAG 


ATGAAT 

rt I u rtrt I 


K9 


GCTTCA 


GGGTGG 
LLL 1 uu 


CIO 


AGAGGT 

/au nu u i 


ATGATA 

rt I Urt I rt 


K10 


GCTTGT 


GGGAGG 

LLUrtUU 


Cll 


AGAGTC 

nvjnU I L 


ATGTAA 

rt P U I rtrt 


Kll 


GGAAGT 

UUrtrtU 1 


rCGCAG 

LLU LrtU 


C12 


AGATGG 

rturt I U U 


ATTAAG 
rt l \ rtrtu 


K12 


GGAATG 

U Urtrt 1 u 


GGGGGA 

LLu Lurt 


C13 


AGGAGT 

/AU UrtU I 


ATTACT 


K13 


GGAGAA 

U U rt U rtrt 


GGGGAG 

LLU UrtL 


C14 


AGGATG 

/AU V_/A I \^ 


ATT AG A 

rt I I rtUrt 


K14 


GGATGA 

U Urt 1 U rt 


GGGGGA 

LLU U L/A 


C15 


AGGGAT 

rtULLrt I 


ATT AT C 


K15 


GGATTG 

U Urt 1 1 L 


CCGGGT 


C16 


AGGGTA 

HULL I /A 


ATT CAT 


K16 


GGGATA 
u u Lrt 1 rt 


GGGGTG 

LLu u 1 U 


C17 


AGGGAA 

rtU LU /A/A 


ATTCTA 


K17 


GGCTTT 


GGGTGG 

LLU 1 LU 


C18 


AGCGTT 

rtULU I I 


ATTGAA 

rt I I Urtrt 


K18 


GGGAAA 

U U U rtrtrt 


CCGTGC 

LLU 1 U L 


C19 


AGCTAC 

rtUL I /AL 


ATTGTT 


K19 


GGGTAT 

U UU 1 rt 1 


CCTCGG 

LL 1 LU U 


C20 


AGGTGT 

rtU L I L I 


ATTTAC 


K20 


GGGTTA 

U U U 1 1 rt 


GGTGGG 

LL 1 ULU 


C21 


AGGTGA 

/A U I U /A 


ATTTCA 


K21 


GGTAAG 

U U 1 rt/AL 


GGTGGG 

LL 1 U U L 


C22 


AGGTTG 

rtU L I I U 


ATTTGT 


K22 


GGTAGA 

UU 1 rtLrt 


GGAGGG 

LUrtLLL 


C23 


AGGACT 


ATTTTG 


K23 


GGTGTT 


CGACGG 

LUrtLU U 


C24 


AGGAGA 

/AU UrtUrt 


GAAAAT 

Lrtrtrtrt I 


K24 


GGTTCT 


CGAGCG 

LUrtU LU 


Dl 


AGGCTT 


CAAATA 

Lrtrtrt I rt 


LI 


GGTTTG 


CGAGGC 

LU/AU UL 


D2 


AGGGTA 

rtU U U I M 


TAATAA 

Lrtrt I rtrt 


|_2 


GTAAGG 

u 1 rtrtLL 


GGGAGG 

LuLrtLL 


D3 


AGGTAG 

rtU U I 


GATAAA 

Lrt I rtrtrt 


L3 


GTAGGT 

U 1 /ALU 1 


GGGAGG 

LU LrtU U 


D4 


AGGTGA 

rtU U I Lrt 


CATATT 


L4 


GTAGAG 

U 1 rtUrtU 


GGGGAG 

LU LLrtU 


D5 


AGGTGT 

rtU U I U I 


CATTAT 


L5 


GTAGGA 

U 1 rtULrt 


GGGGGT 

LU LLL 1 


D6 


AGTAGG 

nu I Hu L 


CATTTA 


L6 


GTAGTG 
u 1 rtu 1 L 


GGGGGA 

LuLLurt 


D7 


AGTGAG 

/AU I U/AU 


GTAAAA 

L I rtrtrtrt 


L7 


GTATGG 

U 1 rt 1 UL 


GGGGTG 

LULL 1 L 


D8 


AGTCGT 

rtU I LU i 


CTAATT 


L8 


GTCAGA 

U 1 LrtUrt 


CGCGAC 

LULUrtL 


D9 


AGTGTG 

rtU I LI L 


CTATAT 


L9 


GTGGAA 

u 1 L Lrtrt 


GGGGGA 

Lu Lu Lrt 


D10 


AGTGAG 

rtu I U /AL 


CTATTA 


L10 


GTCCTT 


GGGGGT 

LU LU U 1 


Dll 


AGTGGA 

/AU f U V— /A 


CTTAAT 


Lll 


GTGGTA 

U 1 LU 1 rt 


GGGGTG 

LU LU 1 U 


D12 


AGTGTG 

rtu IUIU 


CTTATA 


L12 


GTCTAC 


CGCJCG 

LU L 1 LU 


D13 


AGTTCC 


CTTTAA 


L13 


GTCTCA 


CGCTGC 


D14 


ATACCC 


GAAATT 


L14 


GTCTTG 


CGGACG 


D15 


ATAGGC 


G A AT AT 


L15 


GTGAAC 


CGGAGC 


D16 


ATCAGG 


G A ATT A 


L16 


GTGATG 


CGGCAC 


D17 


ATCCAC 


GAT A AT 


L17 


GTGCAT 


CGGCCA 


D18 


ATCCCT 


GATATA 


L18 


GTGCTA 


CGGCGT 


D19 


ATCCTG 


G ATT A A 


L19 


GTGGTT 


CGGCTG 


D20 


ATCGGA 


GTAAAT 


L20 


GTGTAG 


CGGGAG 


D21 


ATCGTC 


GTAATA 


L21 


GTGTGT 


CGGGCT 


D22 


ATCTCG 


GTATAA 


L22 


GTGTTC 


CGGGGA 


D23 


ATGACC 


GTTAAA 


L23 


GTTACG 


CGGGTC 


D24 


ATGCGA 


GTTATT 


L24 


GTTAGC 


CGGTCC 


El 


ATGCTC 


GTTTAT 


Ml 


GTTCAG 


CGGTGG 



set 2 (D3) 



E2 


AJGGCJ 

H I U U L I 


GTTTTA 


M2 


GTTCTC 


V_U I LLU 


E3 


HI UU 1 U 


TAAAAT 


M3 


rjTT^Ar 

U I I UHV_ 


CGTCGC 

LU I LUL 




ATGTGC 
H 1 U 1 OL 


TAAATA 
1 HHMLM 


M4 


G~V~VGt r 
U I I UL I 


LU I ULL 


CD 


H 1 1 LLu 


TAAAl^T 
1 HMMU 1 


rwic 

IVI D 


(^TT(^T(^ 
U I I U I U 


CGTGGG 
LU I UUU 


E6 


AT J CGC 

H I 1 LuL 


TAAATf^ 

1 /A/Art 1 U 


M6 


GTTTCC 


L I LLLU 


F_7 


H 1 1 ULL 


TAATAA 
1 HHLnH 


M7 


GTTTGG 


L I LLU L 


E8 


ATTf^R 


TAACTT 


M8 


TAArrr 

I HHLLL 


CJCGGG 

L I LU UU 


E9 


CAACAC 


TAAf^AT 

1 HHUH 1 


M9 


TAAf^f^r 

I HHUU 


CJGCGG 

L I U LUU 


E10 


rAArrA 


TAAf^TA 

1 HHU 1 H 


M10 


TATAf^n 


CJGGCG 

L I U ULU 


Ell 


LrtMLu 1 


TAATA(^ 
1 HM 1 HU 


Ml 1 
IVI J. i 


I HLLUH 


CTGGGC 
L I UUUL 


E12 


TA ATTf^ 
v-MML 1 U 


TAATrT 
1 HH 1 L 1 


Ml? 
IVI J.Z 


JAGCTG 
I HLL I U 


GACCCG 
UHLLLU 


E13 


rAAriAr; 


TAATf 1 ! A 

1 HH 1 UH 


M13 


TATGTT 


GACCGC 
UHLLUL 


F1 A 


TA A(^n A 


TAATTr 
1 HH 1 1 L 


Ml A 
IVI ±H 


JACGTC 
I HLU I L 


GACGGC 
UHLULL 




LHMu 1 L 


TArAAA 


MIC 
IVI ±D 


TArTri^ 

I HL I LU 


(2 ACGGG 
UHLUU U 


E16 


LHM 1 LL 


TACATT 


M16 


I HL I UL 


GAGCCC 
UHU LLL 


E17 


TAPAAr 


TACT AT 


M17 


TAf^Arr 

I HUH\^*_ 


UHU LU U 


FIB 
CIO 


TATAl^A 


1 HL 1 1 H 


M18 


TAGCAG 
I HULHL 


GAGGCG 
UHUULU 


F1 Q 


f~ ACf^TT 
LrtLU 1 1 


TA(^AAT 
1 HUHH 1 


M19 


TAt^rr^T 

I HULU I 


GAGGGC 
UHUUUL 


E20 


CACTCT 


TA(^ ATA 

1 HUH 1 H 


M20 


TA(^r;A(^ 

I HU UHU 


GCACCC 

ULHLLL 


E21 


TATTT^ 
LML 1 1 U 


TAi^TAA 
1 HU 1 HH 


M91 
IVIZJ. 


I HUULH 


GCACGG 
ULHLUU 


E22 


CAG ACT 


TAGTTT 


M22 


TATCCG 
I H I LLU 


GCAGCG 
U LHULU 


E23 


^nun 1 L 


TATAAfi 

1 H 1 HHU 


M23 


TATrnr 

I H I LUL 


GCAGGC 

U LHUU L 


E24 


TAl^rAT 
LAULM 1 


TAT ACT 


M24 


TATGCC 


GCCACC 

U LLHLL 


Fl 


TAf^TA 
LHu U 1 H 


TATAf^A 
1 H 1 HUH 


Nl 


TATf^(^(^ 
I H I UUU 


GGCAGG 

U LLHU U 


F2 


Lttu 1 Hu 


TATATr 
1 H 1 H 1 L 


N2 


I LHHLU 


GGCCAG 
ULLLHU 


F3 


LHu 1 U 1 


TATCAT 


N3 


TPATAT 
I LHLHL 


GCCCCJ 
U LLLL I 


F4 


LH 1 HLU 


TATCTA 


N4 


TrArrA 

I LHLLH 


GCCCGA 

ULLLUH 


F5 


C AT AGC 
LH 1 MUL 


TATG A A 
1 H 1 UHH 


i\id 


TPAf^ AG 
I LHUHU 


GCCCJC 

ULLL I L 


F6 


LH 1 LL 1 


TATGTT 


N6 


TPAf^TT 

I LnUL I 


GCCGAC 

ULLUHL 


P7 


CATCGA 

LH 1 LUM 


TATTAC 


N7 


TrAf^f^A 

I l—HUUH 


GCCGCA 

ULLU LH 


CO 

ro 


LH ILIt 


TATTPA 
1 H 1 1 LH 


N8 


I LHU I L 


GCCGGT 
ULLUU I 


F9 


CAT G AC 


TATTGT 


N9 


TrATt^r 

I LH I U L 


GCCGTG 

ULLU I U 


F10 


CATGCA 


TATTTG 


N10 


TCCAGT 


GCCJCG 

ULL I LU 


F1 1 


LH lUlU 


TrAAAA 
1 LHHHH 


Nil 


TrrATi^ 

I LLH I U 


ULL I UL 


F12 


LH 1 luu 


TCAATT 


N12 


TrrrA a 

I LLLHH 


GCGACG 
ULUHLU 


F13 


f~f~ A Af^ A 


TCATAT 


N13 


TCCCTT 


GCGAGC 
ULUHUL 


F14 


rr AATK 

LLHH 1 U 


TCATTA 


N14 


TrrTAf^ 

I V_V_ I HU 


GCGCAC 
ULU LHL 


F1 


LLHU 1 H 


TCTAAT 


N15 


TrrTrT 

I LL I L I 


GCGCCA 
ULU LLH 


F1 fi 


LLH 1 (J 1 


TCTATA 


N16 


TrrTf^A 

I LL I UH 


GCGCGT 
ULULU I 


F17 


LLH 1 1 l 


TCTTAA 


N17 


Tr^ATT 

I LUHL I 


GCGCJG 

ULUL I U 


F1 P. 
rio 


rrrAAT 


Ti^AAAT 
1 U HHH 1 


N18 


I LUHUH 


GCGGAG 
ULUUHU 


F19 


err at a 

LLLn 1 H 


TG AATA 
1 UHH 1 H 


N19 


TCGATC 
I LUH I L 


GCGGCT 
ULUU L I 


F20 


CCCTTT 


TfJATAA 

I UH 1 HH 


N20 


TCGGTT 


ULUU UH 


F21 




TGATTT 


N21 


I LU I HL 


GCGGTC 
U LUU I L 


F99 
rzz 


LLU 1 H 1 


Ti^TAAA 
1 U 1 HHH 


N22 


JCGTCA 
I LU I LH 


GCGJCC 
ULU I LL 


rzj 


LLO 1 1 H 


Tl^TATT 
1 U 1 H 1 1 


N23 


TCGTGT 
I LU I U I 


GCGTGG 
ULU I UU 


F24 


CCTAAC 

LL 1 nHL 


TGTTAT 


N24 


TCGTTG 


GCTCCG 

U L I LLU 


Gl 


LL 1 HLH 


TGTTTA 


01 


TPTArr 

I L I HLL 


U L I LUL 


G2 


LL 1 UHn 


TTAAAf^ 
1 1 HHHU 




TCTCGT 


UL I ULL 


G3 


CCTGTT 


TTAACT 


03 


TCTCTG 


UL I UUU 


G4 


LL 1 1 HU 


TTAAf^A 

1 1 HHUH 


04 


TCTGAC 


GGACGC 

UUHLUL 


U J 


LUHHMu 


TTAATr 
1 1 HH 1 L 


LO 


I L I I LU 


GGAGCC 
UUHULL 


G6 


CGAACT 
LU nnL 1 


TTACAT 


06 


TflAAf^r 

I UHHU L 


GGAGGG 

UUHUU U 


G7 


LU HH 1 L 


TTACTA 


07 


TflArAn 

I UHV-.HU 


GGCACG 

UU LHLU 


fro 


T^ATAA 


TTAi^AA 
1 1 HUHH 


Uo 


Tf^Ari^T 
I UHLU I 


GGGAGC 
UULHUL 


G9 


CG AG, AT 


TTAGTT 


09 


TAATTr 
I UHL I L 


GGCCAC 
UU LLHL 


G10 


CG ATAT 


TTATAC 


m n 


Tf^ Al^Ar 
I UHUHL 


UU LUHU 


Gil 


CGATCA 

1 LH 


TTATCA 


011 


T^AfiTA 

I UHUV-.H 


GGCGC1 

UU LU L I 


r;i 9 
u j.z 


LULHI 1 


TTATf^T 
1 1 H 1 U 1 


m 9 


TG Al^Tf; 
I UHU I U 


GGCGGA 
UULUUH 


U 13 


CG TTAA 
LUL 1 rtrt 


TTATT(^ 
1 1 H 1 1 U 


U J. J 


TGATCG 
I UH I LU 


GGCGTC 
UULU I L 


G14 


rnr;AAT 


TTCAAT 


014 


TGCAAG 

I U LHHU 


GGCTCC 

UUL I LL 


U J. J 


CGG ATA 

LUUH 1 H 


TTPATA 
1 1 LH 1 H 




TCTATA 
I ULHLH 


GGGACC 
UUUHLL 


G16 


CGGTTT 


TTCTAA 


m fi 


TGCG AT 
I U LUH I 


GGGAGG 
UUUHUU 


G17 


rfiTAHT 

LU 1 HU 1 


TTfi AAA 

1 1 UHHH 


017 


JGCGJA 

I U LU I H 


GGGCAG 

UUU LHU 


G18 


CGJ AJG 

LU IrtlU 


TTGATT 


Ulo 


I UL I U I 


GGGCCT 
UUULL I 


U J.3 


Tl^TrAT 
LU 1 LH 1 


TTl^TTA 
1 1 U 1 1 H 


m q 

LJ iJ 


Ti^AAr 
I UUHHL 


GGGCGA 
UUULUH 


uzu 


Tf^TrTA 
LU ILIH 


TTTAAT 
1 1 1 HHL 


n9n 


T(^f^ A(^T 
I UUHU I 


GGGGTC 
UUUL I L 


G21 


CG1TGA 

LU 1 1 UH 


TTTACA 


021 


TRf^ATr; 

I UUH I U 


GGGGAC 

U UUUHL 


G22 


CGTTTC 


TTTAGT 


022 


Tf^TAA 

I UU LHH 


GGGGCA 

U UUU LH 


G23 


TTA ACG 
L 1 MHLU 


TTTATG 


D93 


TGGTCT 


U UUU U I 


G24 


CTAAGC 

L 1 HHU L 


TTTCAA 


024 


I UU I UH 


GGGGTG 
UU UU I u 


HI 


TTArAH 

L 1 nV,nU 


TTTCTT 


PI 


TGGTTC 


GGGTCG 

UU U I LU 


1-49 


rTArrT 

L 1 HLL 1 


1 1 1 U 1 H 


P9 
rZ 


Tf^TA(^(^ 
I U I HUU 


UUU I UL 


H3 


CTACGA 
L 1 nLun 


TTTTAG 


P3 


TfiTrAr 

I U I LHL 


GGJCCC 

UU I LLL 


H4 


cjacjc 

L 1 HL 1 L 


TTTTCT 


P4 


TGTCCT 


GGJGCG 

UU I U LU 


riD 


TTAl^Ar 
L 1 HUHL 


TTTTf^A 
1 1 1 1 UH 


rD 


Tf^Tf^Af^ 
I U I UHU 


UU I UUL 


H6 


L 1 HUU 1 


TCTTTC 


Pfi 


TGTGGA 
I U I UUH 


U I LLLL 


H7 


CTATGG 
LIHIuU 


TTGGAT 


P7 
r / 


TGTGTC 


GTCGCG 
U I LULU 


H8 


L 1 LnL 1 


Arrf^TA 

nLLU 1 H 


P8 


TGTTGC 


GJCGGC 

U I LUU L 


HQ 


TTPATr 
L 1 LH 1 L 


AGACCT 
HUHLL 1 


PQ 


TTACGG 
I I HLUU 


GTGCGC 
U I ULUL 


H10 


rTrrTA 

L 1 LL 1 H 


HUUUH 1 


P1 n 

rlU 


I I HULL 


GTGGCC 
U I UULL 


Hll 


TTPf^AT 

L 1 LUH 1 


ATCGAG 

H 1 LUHU 


Pll 


TTrArr 

I I LHLL 


U I UU UU 


n ±z 


TTrTAf^ 
L 1 L 1 HU 


CAAGCT 
LHHUL 1 


P1 9 
r J.Z 


TTrrrA 

I I LLLH 


I LLLLU 


H13 


CTCTGT 


CACCAA 


P13 


TTCGAC 


TCCCGC 


H14 


CTGAAG 


CAGTCA 


P14 


TTCGGT 


TCCGGG 


H15 


CTGAGA 


CATCAG 


P15 


TTCGTG 


TCGCGG 


H16 


CTGCTT 


CATGGT 


P16 


TTCTGG 


TCGGCG 


H17 


CTGGAA 


CCACAT 


P17 


TTGACG 


TCGGGC 


H18 


CTGTAC 


CCGATT 


P18 


TTGAGC 


TGCCCC 


H19 


CTGTCT 


CGACTT 


P19 


TTGCAG 


TGCGCG 


H20 


CTGTTG 


CGATTG 


P20 


TTGCCT 


TGCGGC 


H21 


CTTACC 


CTAGTG 


P21 


TTGGGA 


TGGCCG 


H22 


CTTAGG 


CTTCTG 


P22 


TTGGTC 


TGGCGC 


H23 


CTTCAC 


GAAGAC 


P23 


TTTCCC 


TGGGCC 


H24 


CTTCCA 


GATCGT 


P24 


TTTGCG 


TGGGGG 



Supplementary Table S3 - smFISH probes 
Gene name Probe no Probe sequence (5' -> 


TCF25 


1 


AG A TCGAAA TGCAAGGCGCC 


TCF25 


2 


AAGCGGTTGTTGACTCGGAC 


TCF25 


3 


GGGTCATCCTCAAGATCGTC 


TCF25 


4 


TTTGTTCCCTGGTGCCACAG 


TCF25 


5 


TGTTTCCACGCTGACCCCTT 


TCF25 


6 


ATGAGACTGCTCTGAGGGCA 


TCF25 


7 


CTTCTTCCGGAGTTTGCCAC 


TCF25 


8 


CCTCTCTAGGATGCGATCGA 


TCF25 


9 


TCAACCCAGTGCTGTCCTCA 


TCF25 


10 


AACGTGCTTCCTGGAGCTCA 


TCF25 


11 


AGTGTCTGTGCTCCACGTAG 


TCF25 


12 


CCCGGGCACCAAAATACCTT 


TCF25 


13 


TTGTCTCTGCCGTGGCCTTT 


TCF25 


14 


CATGTGCACTTGGGGTACAC 


TCF25 


15 


GGTGCTTTTAGGGGTGGTCA 


TCF25 


16 


AGACCTGGTTTGCTGTAGCG 


TCF25 


17 


TTGATTCCAGCAGCCGCATG 


TCF25 


18 


CGCAAAGAAGGAGAGGCCTT 


TCF25 


19 


GGTACTCCTCACTGTGCTCA 


TCF25 


20 


AGGAACTTGTGCTGAGCCTG 


TCF25 


21 


TTCGGCTCCATAGACTCCAC 


TCF25 


22 


CTGGAGCAGAACCACGATGT 


TCF25 


23 


AGTCAACGTGGTAAGGGCTC 


TCF25 


24 


TCTTGAAAGCGGCAGGCATC 


TCF25 


25 


GTCTCGAGCCATCTCCTGAT 


TCF25 


26 


TGTACAGCGCTCTCTCTACG 


TCF25 


27 


GGGTGGAACGCACATTCCAT 


TCF25 


28 


CCCACTGGTGAGACTGAACA 


TCF25 


29 


TTCTCGGGTCTGCGGTAATC 


TCF25 


30 


TAGAGGGCCAGGTAGAAGCT 


TCF25 


31 


CTCCAGGAAGCTCATCTGCT 


TCF25 


32 


TGAGCTTGCAGTACTCCAGC 


TCF25 


33 


TCAGGTACTCGTAGTTCCGG 


TCF25 


34 


TTAGGGAGCTGGGACAGGTT 


TCF25 


35 


CCAGTGGAACAGAGAAGGCA 


TCF25 


36 


CTGCTGGCTCAGCAGGAAAT 


1 LrZj 


3~7 
61 


a /""a /"V""F/'""TVV""F/'" , a /"*a /"•TVa f 
/iLr/iC?C ILi (jL- 1 UAUAL. 1 UALr 


TCF25 


38 


ACTCCAGGGAACATGGTGAG 


TCF25 


39 


ACACTGCAAGACTCGAGCAG 


TCF25 


40 


AAGCGGTGACTGGAAACGCT 


TCF25 


41 


GGGGCTGGCTTATTTCAGCA 


TCF25 


42 


CAGAGAAAGTGTGACCTCCC 


TCF25 


43 


TGCTTGCAGAACCTCGTGGA 


TCF25 


44 


ATATTCCTGGGTGCACGCTG 



TCF25 45 

TCF25 46 

TCF25 47 

LPL 1 

LPL 2 

LPL 3 

LPL 4 

LPL 5 

LPL 6 

LPL 7 

LPL 8 

LPL 9 

LPL 10 

LPL 11 

LPL 12 

LPL 13 

LPL 14 

LPL 15 

LPL 16 

LPL 17 

LPL 18 

LPL 19 

LPL 20 

LPL 21 

LPL 22 

LPL 23 

LPL 24 

LPL 25 

LPL 26 

LPL 27 

LPL 28 

LPL 29 

LPL 30 

LPL 31 

LPL 32 

LPL 33 

LPL 34 

LPL 35 

LPL 36 

LPL 37 

LPL 38 

LPL 39 

LPL 40 

LPL 41 

LPL 42 



AGAGAGGA TCACA TGGCGGT 
ATCACAGACTGCGTGGTCAC 
GGCCTGACGTAGGAGTAGAT 

GGTCCTTAGGGCAAATTTAC 
CCAACTCTCATACATTCCTG 
GAGTCTGGTTCTCTCTTGTA 
CTCCATCCAGTTGATAAACC 
GTATCCCAAGAGATGGACAT 
TTGGTCAGACTTCCTGCAAT 
GGCCAGTAATTCTGTTGACT 
CTGCATCATCAGGAGAAAGA 
GTGAATGTGTGTAAGACGTC 
CCATTCGGGTAAATGTCAAC 
ACATCCTGGCTGAAAAGTAC 
CTGTAGGCCTTACTTGGATT 
GAACGAGTCTTCAGGTACAT 
GAAGACTTTGTAGGGCATCT 
CTCTCAGTCCCAGAAAAATG 
GTGCCATACAGAGAAATCTC 
GAAACTTCAGGCAGAGTGAA 
CTCCAATATCTACCTCTGTG 
CACTCTTCCATTTGAGCTTC 
GTCTGACCAGCTAAAGTATG 
CCTAGAACAGAAGATCACCT 
CCTTTCTGCAAATGAGACAC 
TGTCCTCAGCTGTGTCTTCA 
CCAGTCCACCACAATGACAT 
CCAGAGGGTAGTTAAACTCC 
AAGTTAGGTCCAGCTGGATC 
CCAACTGGTTTCTGGATTCC 
CCAAGTCCTCTCTCTGCAAT 
CTTCACTAGCTGGTCCACAT 
AAAGGCTTCCTTGGAACTGC 
AACTCAAGCAGAGCCCTTTC 
AGCAGGGCTTTGCTCTCCAT 
TCCAGCCA TGGA TCACCA TG 
ACTCGGGGCTTCTGCATACT 
CGCGGATAGCTTCTCCAATG 
GATGTTCTCACTCTCGGCCA 
CACAAATACCGCAGGTGCCT 
ACTCCGGGAATGAGGTGGCA 
ACAGGTAGCCACGGACTCTG 
AATGCTCCTGAGCCCGTGAC 
CCACACGGCCAGAGTCAGCA 
GGGCGGCCACAAGTTTTGGC 



LPL 43 

LPL 44 

LPL 45 

LPL 46 

LPL 47 

G0S2 1 

G0S2 2 

60S2 3 

G0S2 4 

60S2 5 

G0S2 6 

60S2 7 

G0S2 8 

G0S2 9 

G0S2 10 

G0S2 11 

G0S2 12 

G0S2 13 

G0S2 14 

G0S2 15 

G0S2 16 

G0S2 17 

G0S2 18 

G0S2 19 

G0S2 20 

G0S2 21 

G0S2 22 

G0S2 23 

G0S2 24 

G0S2 25 

G0S2 26 

G0S2 27 

G0S2 28 

G0S2 29 

G0S2 30 

G0S2 31 

G0S2 32 

G0S2 33 

G0S2 34 

G0S2 35 

G0S2 36 

G0S2 37 

G0S2 38 



TGGTGTAGCCCGCGGACACT 
GCCACATCCTGTCCCACCAG 
CAGCAGCATGGGCTCCAAGG 
TGCTTCGACCAGGGGACCCT 
GAATGGAGCGCTCGTGGGAG 

GGACATTGATTGGTTTCGGC 
TGGCTGGATTGCAAACTCCA 
CCGATAGTCTTTACCACCTG 
AAAGTACCACACTTCCCGGA 
CAGCCAGGTAGGAAATCCTT 
CAGACACCTTCTTATCCAGC 
CTTCCTTCACTTGGAGGAAG 
GGCAGTAGATCTCATCGCTA 
CCCAGACTTGTGCACTTCTT 
CCCTGGTAAGTTTGTGCTGG 
GGTCCTGAGCAATCTTCAGG 
CCAAGCCAAAGGTCTGTTCC 
GTGCCTTCTTGTCGATGGGT 
GATTCTCAGACGTGGGGCAT 
CTGCGGCGCATATACAACTC 
CTCTCCACGGTTTCTCTCCT 
CGCGCATCATCTGCTCTTTC 
GCTGCTCCTGGCTCTTTATC 
TATTCTGCAAGCTCCGCAGC 
CAGGTCATCCTGGGCTTCTT 
GCCTCATGTTCTCGTTGTGG 
CCGGAACTTGAACTGGAGGG 
ATCAGCCGCTCAGAGCTGAG 
AGAGCTGCAGGATCCGCTTG 
CACCTCGATGGTGTCAGGCT 
TTCCAGCTGTTGCCGCTCCA 
AGGGCCCTCTGAATCTGCTC 
ATACGGTCAGCCTCTAGGCG 
CAGGAGGGCAATCTTGGCAG 
TTCATCCTCCTTGCGCCTCC 
CCCTGTGCTGCCACTCTTCA 
TAGCTCACCGGCTCGTACAC 
TAGACAGCTCCGCGCTGTAG 
ATTGCGGTCATCCCGGATGC 
CCTCAGTGATGCGCTTCTCC 
TTCTCATCTCGGGCCTGGGA 
GTCTTGTACTTGTCCCGGCC 
CTCGAACTCGTCGATGCGCT